Iowa State University

Iowa State University

Biological Materials and Processes (BioMaP)

Research Experience for Undergraduates (REU)

Quick Links


150 Years

NSF

Research projects for Summer 2007

1. Activation of Immune Cells by Polyanhydride Nanospheres (Narasimhan and Lapizco)

The Narasimhan lab has developed new biodegradable polyanhydride nano-adjuvants to understand the cellular and molecular mechanisms that establish immunologic memory. They have designed nanospheres based on sebacic acid (SA), 1,6-bis(p-carboxyphenoxy)hexane (CPH), and α,ω-bis(p-carboxyphenoxy)tri ethylene glycol (CPTEG), and demonstrated the stability of antigens released from these nanospheres. They are evaluating the uptake of antigen-loaded nanospheres by antigen-presenting cells (APCs, e.g., macrophages and dendritic cells) and using in vitro and in vivo approaches to discern the influence of polymer chemistry on APC activation. Lapizco has developed dielectrophoresis (DEP)-based methods for the separation and concentration of cells, proteins, and nanoparticles. They have designed a new class of micro-devices called insulator-based DEPs (iDEP). In this device, non-uniform electric fields are created with an array of insulators instead of electrodes. Separation of the particles takes place inside micro-channels within the insulating structures. Insulating materials such as polymers have excellent malleability and because they can be mass-replicated, provide for high-throughput and large-volume devices. Below, we describe a collaborative project that will provide a stimulating research experience for an REU student.

fig 1Layout of micro-device geometries for iDEP experiments for cell screening. Different layouts will be employed, and each layout will be used with two of eight microchannels with varying post diameters (40-80 μm) and center-to-center distance (300-500 μm).

Example REU Project: Students will prepare 50-500 nm polyanhydride nanospheres loaded with FITC and based on copolymers of SA, CPH, and CPTEG. These nanospheres will be incubated with the J774.1A macrophage cell line to ascertain adjuvanticity (i.e., activated macrophages) and tested for uptake and cellular activation using cytokine profiles. Students will also use lithography at the ISU Keck Laboratory (consisting of class 10/100 clean rooms) to fabricate micro-devices of glass, polyimide, or poly(methyl methacrylate). These devices will contain micro-channels and an array of cylindrical posts (Fig. 1) inside the micro-channels, whose surface and geometry will affect the dielectrophoretic response obtained from the cells. This response will be used to distinguish the cells that have taken up the nanospheres. These micro-devices and the cells will be analyzed by iDEP at ITESM using synchronized video microscopy. By working on this project, the student will learn: (a) nanosphere fabrication; (b) fabrication of patterned substrates; and (c) cell screening.


2. Molecular Design of Immunomodulatory Vaccines (Narasimhan)

We have developed novel biodegradable amphiphilic polyanhydride nano- adjuvants to modulate the immune response from an antigen-mediated (humoral) to a cell-mediated immune response. This immunomodulatory capability has important implications for the design of vaccines for various intra-cellular pathogens such as cancer and HIV. We have designed nanospheres (see Fig.) based on sebacic acid (SA), 1,6-bis(p-carboxyphenoxy)hexane (CPH), and α,ω-bis(p-carboxyphenoxy)tri ethylene glycol (CPTEG) and demonstrated the stability and immunogenicity of antigens released from these nanospheres.

Example REU project: The student will fabricate antigen-loaded nanospheres of various sizes and chemistries and immunize mice. The antigens of interest include ovalbumin, tetanus toxoid, F1-V protein, pertussis toxoid, and rPA (anthrax vaccine). The immune response in these animals will be characterized using both antigen-specific antibody responses (including isotypes) and T cell proliferative responses. This experimental project will expose the student to nanosphere fabrication, protein biochemistry, in vivo studies, and applied immunology.


3. Smart Polymers for Drug and Gene Delivery (Mallapragada)
The Mallapragada laboratory has designed and synthesized novel smart multi-block copolymers that exhibit pH and temperature sensitivity. These polymers are cationic and undergo thermoreversible gelation at body temperatures. Since the critical gelation temperatures are close to room temperature, these polymers can be used as injectable delivery devices and have significant advantages over other crosslinked stimuli-sensitive hydrogels that have been investigated. These polymers are ideal candidates for self-regulating systems for drug delivery. We have obtained insights into dissolution and release mechanisms from these and other gels using novel diffusional and spectroscopic techniques coupled with predictive models. These cationic polymers exhibit complexation with DNA and serve as excellent injectable controlled gene delivery vectors.

Example REU project: Students will work with the pentablock copolymers synthesized in our laboratory and investigate the complexation of DNA with copolymers of various chemistries, block architectures and cationic content. The students will then test the transfection ability of the promising complexes in normal as well as cancer cell lines, to investigate the efficacy of these new polymers in delivering suicide genes selectively to cancer cells. These studies will be conducted at concentrations where the polymers form gels, and the ability to obtain sustained gene expression over time will be investigated by the students. Through this experience, the student will learn 1) mammalian cell culture techniques; 2) molecular biology techniques such as gel electrophoresis; and 3) integration of engineering and biological approaches.


4. Micropatterned Polymer Substrates For Growth of Neural Stem Cells (Mallapragada)

We have designed micropatterned polymer substrates (Fig. 2) to control neuronal outgrowth and promote peripheral nerve regeneration. Studies are underway to extend these approaches to central nervous system regeneration, specifically in the case of the optic nerve, using astrocytes and adult rat neural stem cells and promoting their directed outgrowth and differentiation. Current knowledge suggests that the pattern formation and differentiation of stem cells into various cell types that occur during brain development is guided by a variety of signals, including preformed distributions of extracellular matrix proteins and growth factors. A thorough understanding of this differentiation is important not only to answer fundamental questions in biology related to the elaborate organization of the mammalian brain, but also to control the differentiation of neural stem cells in a tissue-engineered scaffold to promote regeneration.
fig2

Neurites on polymer substrate with smooth top half and micropatterned bottom half.

Example REU Project: We have developed substrates made of polystyrene and poly(lactide-co-glycolide) with micropatterns of various proteins using photolithography. The REU student will investigate the growth and differentiation of adult hippocampal progenitor cells (AHPCs from rats that we use regularly) on these micropatterned substrates. These studies will test the hypothesis that unique combinations of signals from preformed distributions of extracellular matrix proteins will affect the fate of neural stem cells. The cell culture system will involve AHPCs growing on a polymer substrate micropatterned with proteins such as laminin and basic fibroblast growth factor (FGF). The pattern sizes and order of exposure of the cells to laminin and FGF will be interchanged, and the migration, proliferation, and differentiation of the cells will be monitored using microscopy and morphological characterization. The markers – microtubule-associated protein and glial fibrillary acidic protein - will be used to investigate whether the cells adopt neuronal or glial fates in response to the cues. This is a collaborative effort between Mallapragada’s group and researchers in biochemistry and genetics. Through this experience, the student will learn: a) mammalian cell culture on polymer substrates; b) immunocytochemistry; and c) integration of engineering and biological approaches.


5. Rational design of heterogeneous catalysts for biorenewable conversions (B. Shanks)
The B. Shanks group uses advanced material synthesis techniques to rationally design heterogeneous catalysts for use in the conversion of biorenewables feedstocks. The high degree of functionality in biological molecules as well as the liquid phase reaction environments needed for processing them creates new challenges in the design of solid catalysts. Shown in the figure is a nanostructured organic-inorganic hybrid catalyst designed for the esterification of fatty acids with methanol to produce methyl esters, which is a reversible reaction. The organosulfonic acid moieties were selected to provide sufficient acidity to achieve the esterification reaction and the hydrophobic organic groups created a reaction environment that excluded water from the active acidic sites. The resulting catalyst was more active in the esterification reaction than conventional solid acid catalysts. The B. Shanks group is extending this approach of controlling the reaction domain at the molecular level via spatially controlled multi-functionalization of the pores in nanostructured metal oxides to other biorenewable systems.

Example REU Project: The REU student will synthesize organic-inorganic hybrid catalysts using techniques available in the Shanks group for application in the conversion of carbohydrate derived molecules. The student will attach organic catalytic moieties within the pores of nanostructured silicas and characterize the resulting materials. The characterization techniques that will be used will be adsorption-desorption isotherms for surface area, pore volume, and pore size distribution, x-ray diffraction for metal oxide structure, scanning electron microscopy of catalyst particle morphology, reactor studies for catalyst kinetics. The project will allow the student to learn (a) synthesis techniques for organic-inorganic hybrid catalysts; (b) catalyst characterization techniques; and (c) more about the issues involved in solid catalysts for the conversion of biorenewables.


6. Aptamer-based catalyst design (Woo)

Catalysis is one of the most important applications in industry in terms of manufacturing bulk materials as well as producing pharmaceuticals. Economically, the application of catalysis adds more than $500 B per year to US commerce. Moreover, worldwide sales of catalysts amounts to over $25 B, with a $10.2 B market share in the US. Although catalytic science has made tremendous advances in developing practical catalysts, it is still difficult and arduous to rationally design and improve a new catalyst using first principles. The collective interactions in the active site of a catalyst are extremely intricate and it is not always clear how to organize molecular features to effectively promote the transformation of one or more reactants into products. The intrinsic complexities of many dependent variables have previously forced the use of enormously time-consuming empirical methods to identify and optimize ligands and metal complexes for catalysis. A key challenge in catalysis involves accelerating the creation and optimization of efficient and selective catalytic materials from many possible compositions and structures. In the past decade, combinatorial approaches have been advanced that illustrate new potential for rapidly producing catalyst innovations. In this research, the application of combinatorial techniques and molecular evolution will be applied to homogeneous catalysis based on DNA aptamers generated by the selection scheme shown below.

Example REU project: The student will be involved in testing a family of evolved catalysts for coupling two small molecules. Activities, yields and selectivities will be determined by GC. Structural determination of the most effective catalysts will be undertaken using methods such as NMR spectroscopy and chemical footprinting. In working on this project, a student will become acquainted with a variety of techniques and approaches in chemical, biochemical, and catalytic sciences.

 

 


7. Developing Robust Fluorescent Markers for In Vivo Diagnostics (Clapp)

Colloidal quantum dots (QDs) are nanometer-sized semiconductor crystals that exhibit many desirable and unique optical properties.  In particular, their emission color can be adjusted by varying their size, their brightness is substantially higher than traditional fluorescent probes, they can be excited over a broad range of wavelengths, and they are highly resistant to degradation that can quench their emission.  Given these benefits, QDs are excellent candidates for in vivo imaging studies that are capable of non-invasively revealing biological processes occurring deep within living tissue.  Scattering and absorption are significantly reduced by carefully selecting an appropriate emission wavelength that coincides with a local absorption minimum of the tissue.  Although the inorganic chemistry used to synthesize these QDs provides natively hydrophobic materials, we can tailor the surface chemistry to generate hydrophilic, biocompatible nanoparticles that have multiple functions.

Core-shell quantum dot functionalized with biocompatible capping ligands

Example REU Project:  In this experimental project, the REU student will learn and refine inorganic synthetic techniques for generating these materials (most notably the layer-by-layer SILAR technique), methods for chemically passivating the QD surface and rendering them biocompatible, and testing their performance for in vivo imaging applications.  In particular, their long-term stability in relevant biological conditions and transmission efficiency through thick tissue samples will be evaluated.

 

 

 


8. Molecular Modeling of Peptide Mimics (Lamm)
Peptide mimics are low molecular weight sequences of amino acids that reproduce the key structure or function of a larger protein. In this project, we are using molecular simulation to design a peptide mimic for the protein thrombin. A small thrombin mimic is needed for a specific biomaterials application where a thrombin-DNA aptamer complex is used to link a synthetic block copolymer to a fusion protein. The approximate molecular weights of thrombin and the fusion protein are 30 kDa and 6 kDa, respectively. Hence, it is desirable to design a miniature peptide that mimics the thrombin binding domain to reduce the size of the linking complex relative to the fusion protein and thereby improve linking efficiency. Selecting an appropriate peptide sequence from thrombin is not straightforward in this instance because the binding domain is not a linear sequence of residues. Rather, it is a groove that includes a single helix and non-helical side-chains from other parts of the protein.

Molecular model of thrombin, highlighting the binding domain specific for the DNA aptamer.

Example REU Project: In this computational project, the REU student will conduct molecular dynamics computer simulations to study the binding domain of the protein thrombin. The information learned about the binding domain will then be used to generate several lower molecular weight peptide prototypes. The student will evaluate these peptide prototypes for their ability to bind the DNA aptamer d(AGTCCGTGGTAGGGCAGGTTGGGGTGACT). The REU student working on this project will gain experience with molecular simulation methods and software, and high performance computing.


 

 


9. Recovery of biological products (Glatz and Rito-Palomares)
The Glatz and Rito-Palomares laboratories both work to develop optimal conditions for the recovery of biological products (e.g. proteins, aroma compounds, colorants, inclusion bodies, virus like particles) using a variety of separation methods, most recently aqueous two-phase (ATP) partitioning in PEG-salt and PEG-dextran systems. Intensive study of the behavior of specific proteins, previously well characterized in conventional analyses and purifications, have helped to establish ground rules to predict molecular partition in novel systems based upon quantifying physical and biochemical parameters of system components. Each is interested in further steps for product recovery from these systems and reuse of phase components, which will be the focus of their joint project.

Example REU Project: The two labs have considerable expertise in precipitation, ultrafiltration and chromatography to serve in subsequent process steps. Each lab also has product proteins (see Fig.) of particular interest. These include high-value colored proteins (c-phycocyanin and B-phycoerytrin) from microbial sources and recombinant pharmaceutical/industrial enzymes from corn and also lower-valued proteins that could be byproducts in processing for conversion of biomass to chemicals and fuels. The likely student project will focus on byproduct protein recovery from biomass where the biomass of interest in the Glatz lab is corn and in the Rito-Palomares lab is sorghum. Students will obtain protein extracts and apply suitable separation methods, following recovery by chemical assays, and interpret results in terms of solubility, partition coefficient, or retention time, depending on the separation method.


10. Computation of Enzyme Structure and Function (Reilly)

The Reilly group has performed extensive computational analysis of amino acid sequences of the same enzyme produced by different organisms and of 3-D enzyme structures obtained by crystallography. The crystallography experiments to determine enzyme structure and function are difficult and time-consuming, and computation, which is relatively fast and quite accurate, can greatly expand what is known about the specific enzyme. We have used automated docking with glucoamylase, β-amylase, α-1,2-mannosidase, phospholipase D (Fig. 5), several cellulases, and the non-enzymatic mannose-binding protein C.

fig 5Streptomyces phospholipase D, showing a phosphate group (red and gold) in the active site between the catalytic proton donor (histidine 165) and catalytic nucleophile (histidine 438), and with the essential binding residues lysine 167 and lysine 440.

Example REU Project: The student will study hydrolases, which cleave the glycosidic bonds between sugar residues. She/he will perform two activities: a) Use existing algorithms to align amino acid sequences obtained by different research groups and found in databases. Such alignments will distinguish different subfamilies within an enzyme family, such as glucoamylase, and from this the student can infer that structures and properties of the different forms of the same enzyme produced by different organisms are closer or more distant from each other. b) Use automated docking with the algorithm AutoDock of different ligands, either already known substrates, potential substrates, or inhibitors, into the active sites of enzymes with known structures. This allows the student to understand enzyme function supplement knowledge gained by experimentation.


11. Metabolic Flux Analysis in Plants (J. Shanks)
Metabolic engineering is generally defined as the redirection of enzymatic reactions to improve the production of existing compounds, such as anticancer agents, to produce new compounds in an organism, or to mediate the degradation of environmentally toxic compounds. Plant metabolic flux analysis in the primary carbon metabolic pathways presents the fundamental information on the application of plant metabolic engineering which is based on the knowledge of plant biochemistry and plant cell culturing techniques. We are going to select different genotypes of a plant having high and low protein contents for the comparison of primary carbon fluxes by using 13C-labeled substrates and NMR analysis. If possible, we will also include the progeny of the two genotypes for the comparison study. For the flux analysis, accompanying tasks are to obtain the plant growth curve, to determine the uptake rate of substrates, and to perform NMR data analysis and computer simulations. From this project, axenic plant cell culture techniques, various chemical analysis techniques, and knowledge of fundamental plant biochemistry will be acquired.


12. Aptamer-Based Biomolecular Recognition Systems (Porter)

Immunological recognition is among the most used labeling approaches in bioassays, relying on the high specificity of antibody-antigen binding. Examples include detecting large biomolecules like insulin, small molecules like TNT, and pathogens like E. coli (Fig. 6). These assays, however, suffer from several limitations (batch-to-batch variability, temperature and matrix effects, and cross-reactivity), which may be overcome by a new class of molecular recognition ligands based on nucleic acid oligomers. These ligands, referred to as aptamers, are typically 20-100 base pairs long and are isolated from pools of oligomers with random sequences. Through iterative combinatorial processes known as SELEX (systematic evolution of ligands by exponential enrichment), which entail a series of binding affinity and PCR amplification steps, oligos with high affinity and specificity for a target are isolated from large libraries. Furthermore, aptamers are synthesized by automated processes, which may reduce binding diversity complications when using antibodies.

fig6E. coli O157:H7 tagged with fluorescently labeled (hexachlorofluore-scein phosphoramidite) aptamers: Light microscope image (left); fluorescence microscope image (right)

Example REU Project: The student will apply SELEX and counter-SELEX to develop aptamers for the target pathogen, E. coli O157:H7, central to human health and water supply contamination. The student will perform the following tasks: (a) Design and synthesize an oligo library composed of an internal random region of 40-mers (~1015 sequences after accounting for synthesis inefficiency) flanked by PCR primers; (b) Use SELEX and counter-SELEX to identify most effective binding sequences by: (1) exposing the library to the target organism or cross-reactors (e.g., Salmonella choleragesius) that have been immobilized in a flow-through column, allowing oligos with an affinity to the target to bind; (2) separation of unbound oligos by low stringency washes; (3) elution of bound oligos, now called aptamers, from the target under conditions of varied stringency (pH and salt concentration); and (4) aptamer amplification by PCR (these four steps are repeated 4-8 times to grow sufficiently the most effective binding populations); and (c) Clone the ‘winning’ aptamers into vectors to produce material for sequencing, followed by production in quantities sufficient to further select against the sample preparation environment. In working with the Porter group and collaborators in veterinary medicine, the student will be exposed to several areas of biotechnology and to an environment that will develop life-long learning and working skills.


13. Improving Carbon Conversion in Biomass Gasification Reactors (Brown)
The Brown group works on gasification technology for use in biorefineries. The main issues in gasifying biorenewable feedstocks include ash agglomeration, contaminant generation in the syngas, low hydrogen content, and modest carbon conversion. The latter problem accounts for cold gas efficiencies typically being only 65% and overall thermodynamic efficiencies <90% in converting solid biomass to syngas. We have improved carbon conversion by studying the interaction of fluid dynamics and reaction in fluidized bed reactors. We have designed a laboratory-scale (50 kW) bubbling fluidized bed reactor to simulate near-adiabatic operation that can measure fuel, air, and/or steam flow into the reactor and exit gas composition.

Example REU Project: During the project, the student will learn the operating principles of the fluidized bed reactor and perform system measurements. The student will perform experiments to investigate the role of attrition, elutriation, and gas-solid reactions on carbon conversion. The data will be analyzed using simple analytical models of the reactor system. This is an experimental investigation.


14. A Bayesian Approach for Mutation in Escherichia coli (Rollins)

The Rollins group has expertise in statistics and process modeling to reduce high dimensional data sets and linear/non-linear stochastic modeling relevant to Bayesian Independent Component Analysis. In collaboration with Gonzalez, we are developing a framework for the analysis and integration of large data sets generated by the use of functional genomics.

Example REU Project: In mutagenic polymerase chain reaction (PCR) researchers are interested in the probabilistic prediction of certain types of mutation. In this work, the assumption of independence appears to be quite common but the reality more closely follows dependence behavior (i.e., future mutations depend on what has mutated). The REU student will incorporate statistical modeling using conditional probabilities to model mutations in a specific system based on E. coli. Simultaneously, the student will compare them with real data (obtained from the literature) and make adjustments in the theoretical models. The student will learn the importance of statistical modeling in systems biology and use this to make more realistic comparisons between theory and experiment, thus leading to deeper insights.


15. Stochastic Modeling of Carrier-Cell Interactions in Targeted Drug Delivery (Vigil)

One promising method for increasing the targeting of drugs to cells has been to attach molecules to the surface of the drug carrier (using a poly(ethylene glycol) tether) that bind to specific receptors on the target cells. Usually, when only a single receptor is targeted, off-target drug uptake is significant. However, diseased cells often over-express multiple receptor types, so attaching different ligands to carriers could potentially lead to selective targeting. We have developed stochastic models to simulate carrier-cell interactions and predict the number/type of ligands that optimize the rate and selectivity of drug uptake by target cells.

Example REU Project: Current simulations of ligand-receptor binding assume that receptors remain in fixed positions on the cell surface. However, it is known that receptors can and do move in response to binding events of other receptors. The REU student will carry out a literature search and develop and test appropriate algorithms for simulating receptor mobility. Next, the student will test the effect of receptor mobility on carrier targeting.